Review



rabbit anti pret r d systems af5009  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 92
      Buy from Supplier

    Structured Review

    R&D Systems rabbit anti pret r d systems af5009
    Rabbit Anti Pret R D Systems Af5009, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+pret+r+d+systems+af5009/Human+Phospho-Ret+(Y1062)+Antibody/pmc08751314__13024_2021_510_MOESM7_ESM-1-82-84
    Average 92 stars, based on 11 article reviews
    rabbit anti pret r d systems af5009 - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    other:

    Article Title: Edaravone activates the GDNF/RET neurotrophic signaling pathway and protects mRNA-induced motor neurons from iPS cells
    Article Snippet: GFRA1 CATAGACTCCAGTAGCCTCAGTG GTCACATCGGAGCCATTGCCAA CYGB ACCGCTGCCTACAAGGAAGTGG AAGGAGGGTCTTCAGAACTCGG NQO1 CCTGCCATTCTGAA GGCTGGT GTGGTGATGGAAAGCACTGCCT HOXB5 GACTCCGCAAATATTCCCCTGG GGAACTCCTTTTCCAGCTCCAG PHOX2B CCTGAAGATCGACCTCACAGAG TTTTGCCCGAGGAGCCGTTCTT NKX2.1 CAGGACACCATGAGGAACAGCG GCCATGTTCTTGCTCACGTCCC GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA 18S ACCCGTTGAACCCCATTCGTGA GCCTCACTAAACCATCCAATCGG Antibody Vendor Catalog # Dilution mouse anti-Olig2 Millipore MABN50 1:1000 rabbit anti-HB9 DSHB AB2145209 1:300 rabbit anti-Islet1 DSHB AB528315 1:300 Goat anti-ChAT Millipore AB144P 1:200 rat anti-VGlut1 SYSY 135311 1:300 rabbit anti-GAD67 Millipore Mab5406 1:300 rabbit anti-TUJ1 Cell Signaling Technology 5568 1:500 mouse anti-TUJ1 Cell Signaling Technology 4466 1:500 rabbit anti-Synapsin 1 Cell Signaling Technology 2312 1:200 rabbit anti-pRET R&D systems AF5009 1:1000 rabbit anti-RET Cell Signaling Technology 14556 1:1000 rabbit anti-CAT Cell Signaling Technology 12980 1:1000 rabbit anti-GPX7 GeneTex GTX105683 1:1000 rabbit anti-VGF Origene TA306578 1:1000 rabbit anti-pERK Cell Signaling Technology 9101 1:1000 mouse anti-tERK Cell Signaling Technology 4696 1:1000 rabbit anti-pAkt Cell Signaling Technology 4060 1:1000 rabbit anti-tAkt Cell Signaling Technology 9272 1:1000 rabbit anti-pSrc Cell Signaling Technology 6943 1:1000 rabbit anti-Src Cell Signaling Technology 2109 1:1000 goat anti-GFRA1 R&D systems AF714 1:1000 rabbit anti-GRIA1 Cell Signaling Technology 8652 1:1000 mouse anti-Actin Proteintech 66009-1 1:2000



    Similar Products

    rabbit anti pret r d systems af5009  (R&D Systems)
    92
    R&D Systems rabbit anti pret r d systems af5009
    Rabbit Anti Pret R D Systems Af5009, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+pret+r+d+systems+af5009/Human+Phospho-Ret+(Y1062)+Antibody/pmc08751314__13024_2021_510_MOESM7_ESM-1-82-84
    Average 92 stars, based on 1 article reviews
    rabbit anti pret r d systems af5009 - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier

    Image Search Results